View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11892_low_31 (Length: 264)
Name: NF11892_low_31
Description: NF11892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11892_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 25 - 254
Target Start/End: Original strand, 47506674 - 47506897
Alignment:
| Q |
25 |
cataccacttatttcaacaaattaaaagtgtgtctgtttcaattcaatcatcgatcttatggtataataagagagtttgatattcacaaatcccaatgct |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47506674 |
cataccacttatttcaacaaattaaaagtgtgtctgtttcaattcaatcatc----ttatggtataataagag--tttgatattcacaaatcccaatgct |
47506767 |
T |
 |
| Q |
125 |
ttgactgtccctttctcttctcttgctgctattcattcaaatttgtcactcccgaaacccacggggcagtgtgctcacatggatgaagtgagtatccacc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47506768 |
ttgactgtccctttctcttctcttgctgctattcattcaaatttgtcactcccgaaacccacggggcagtgtgctcacatggatgaagtgagtatccacc |
47506867 |
T |
 |
| Q |
225 |
attattaacataaccttgctggtgtctgtg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47506868 |
attattaacataaccttgctggtgtctgtg |
47506897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University