View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11892_low_32 (Length: 253)

Name: NF11892_low_32
Description: NF11892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11892_low_32
NF11892_low_32
[»] chr8 (1 HSPs)
chr8 (10-253)||(42926012-42926255)
[»] chr6 (1 HSPs)
chr6 (137-238)||(34340353-34340454)
[»] chr3 (1 HSPs)
chr3 (173-241)||(47893965-47894033)


Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 10 - 253
Target Start/End: Original strand, 42926012 - 42926255
Alignment:
10 atgagatgaactgaagagttttcacacaggaagactcaaaagcaagcctgagaggagaaccgtcgtacgaatcaacggagggcacactgcggggactctg 109  Q
    |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42926012 atgacatgaattgaagagttttcacacaggaagactcaaaagcaagcctgagaggagaaccgtcgtacgaatcaacggagggcacactgcggggactctg 42926111  T
110 ttgagtcggagccctaagttgctctgtcgtgtgagcgaaaaaacaaactggccggcgacaactggttccgtctttacacggctgagtacggtaacgcgaa 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42926112 ttgagtcggagccctaagttgctctgtcgtgtgagcgaaaaaacaaactggccggcgacaactggttccgtctttacacggctgagtacggtaacgcgaa 42926211  T
210 ggatgaagccaacactcgaaaacaccatgagcaaactcacacga 253  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
42926212 ggatgaagccaacactcgaaaacaccatgagcaaactcacacga 42926255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 137 - 238
Target Start/End: Complemental strand, 34340454 - 34340353
Alignment:
137 cgtgtgagcgaaaaaacaaactggccggcgacaactggttccgtctttacacggctgagtacggtaacgcgaaggatgaagccaacactcgaaaacacca 236  Q
    |||||||||||| || |||||  |||||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||    
34340454 cgtgtgagcgaagaagcaaacacgccggcgacagctggttccgtctttacacggctgagtacggtaacgtgcaggatgaagccaacactcgaaaacacca 34340355  T
237 tg 238  Q
    ||    
34340354 tg 34340353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 241
Target Start/End: Complemental strand, 47894033 - 47893965
Alignment:
173 ggttccgtctttacacggctgagtacggtaacgcgaaggatgaagccaacactcgaaaacaccatgagc 241  Q
    ||||||||| |||||  ||||||| | |||||| |||||||||||||| || || ||||||||||||||    
47894033 ggttccgtcgttacaaagctgagttctgtaacgagaaggatgaagccagcattcaaaaacaccatgagc 47893965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University