View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11892_low_33 (Length: 250)
Name: NF11892_low_33
Description: NF11892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11892_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 9988446 - 9988663
Alignment:
| Q |
19 |
aaaggggcattgcaaacaatatttgtaacattaatatttggctagcaccctgaannnnnnnggtatatatgtaacctatgaattgaagtagtagtagcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9988446 |
aaaggggcattgcaaacaatatttgtaacattaatatttggctagcaccctgaatttttttgctatatatgtaacctatgaattgaagtagtagtagcta |
9988545 |
T |
 |
| Q |
119 |
acaactnnnnnnngtgcttgcaataataaggagcaaaatagcatgttgaaaagtcttctttgtgatgattattatccattttgcatgaaaaatattaatc |
218 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9988546 |
acaactaaaaaaagtgcttgcaataataaggagcaaaatagcatgttgaaaagtcttctttgtgatgattattatccattttgcatg-aaaatattaatc |
9988644 |
T |
 |
| Q |
219 |
ctactataagcttttgtct |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
9988645 |
ctactataagcttttgtct |
9988663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University