View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11892_low_36 (Length: 240)
Name: NF11892_low_36
Description: NF11892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11892_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 13129087 - 13129310
Alignment:
| Q |
1 |
ctattattccaatttcaaatggtcactgtgtttgctcattttgaatcacaaatgagaagtatagatccaaattatttcagcacctgtgacttcttttcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13129087 |
ctattattccaatttcaaatggtcactatgtttgctcattttgaaccacaaatgagaagtatagatccaaattatttcagcacctgtgacttcttttcta |
13129186 |
T |
|
| Q |
101 |
atgtggaaaccaaacttgatcgaatcatatcagaccagactttgctcaaaccaaatctttccaaactttagacccgtgccagaccaaaagtcatgaatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13129187 |
atgtggaaaccaaacttgatcgaatcatatcagaccagactttgctcaaaccaaatctttccaaactttagatccgtgccagaccaaaagtcatgaatat |
13129286 |
T |
|
| Q |
201 |
gatttggtttggttgttaggattt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
13129287 |
gatttggtttggttgttaggattt |
13129310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 66 - 132
Target Start/End: Original strand, 40508417 - 40508483
Alignment:
| Q |
66 |
tccaaattatttcagcacctgtgacttcttttctaatgtggaaaccaaacttgatcgaatcatatca |
132 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||| || || ||||| ||||| |||||||||||||| |
|
|
| T |
40508417 |
tccaatttattgcagcacctgtgatttcttttccaaagtagaaactaaactgaatcgaatcatatca |
40508483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University