View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11892_low_39 (Length: 224)
Name: NF11892_low_39
Description: NF11892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11892_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 19 - 207
Target Start/End: Original strand, 9988446 - 9988631
Alignment:
| Q |
19 |
aaaggggcattgcaaacaatatttgtaacattaatatttggctagcaccctgaannnnnnnggtatatatgtaacctatgaattgaagtagtagtagtag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
9988446 |
aaaggggcattgcaaacaatatttgtaacattaatatttggctagcaccctgaatttttttgctatatatgtaacctatgaattgaagtagtagtag--- |
9988542 |
T |
 |
| Q |
119 |
ctaacaactnnnnnnngtgcttgcaataataaggagcaaaatagcatgttgaaaagtcttctttgtgatgattattatccattttgcat |
207 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9988543 |
ctaacaactaaaaaaagtgcttgcaataataaggagcaaaatagcatgttgaaaagtcttctttgtgatgattattatccattttgcat |
9988631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University