View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11893_low_14 (Length: 248)
Name: NF11893_low_14
Description: NF11893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11893_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 63 - 240
Target Start/End: Complemental strand, 26840243 - 26840066
Alignment:
| Q |
63 |
ttttcggtgctgctcttctctttttcaacctctgcaaagtatagtgtctacaaagtgtctaaataattacagtatcatttttgtttattgatgcaagtat |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
26840243 |
ttttcggtgctgctcttctctttttcaacctctgcaaagtatagtgtctacaaagtgtctaaagaattacaatatcatttttgtttattggtgcaagtat |
26840144 |
T |
 |
| Q |
163 |
agtgtcatagtggatctcatgatatatgtacagagtgtctaaagaagtatgtgttagtactaataggtcctctctgct |
240 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26840143 |
agtgtcacagtggatctcatgatatatgtacagagtgtctaaagaagtatgtgttagtactaataggtcctctttgct |
26840066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 134 - 240
Target Start/End: Complemental strand, 50975266 - 50975160
Alignment:
| Q |
134 |
gtatcatttttgtttattgatgcaagtatagtgtcatagtggatctcatgatatatgtacagagtgtctaaagaagtatgtgttagtactaataggtcct |
233 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50975266 |
gtatcatttttgtttattggtgcaagtatagtgtcatagtggatctcatgatatatgtgcagagtgtctaaagaagtatgtgttagtactaataggtcct |
50975167 |
T |
 |
| Q |
234 |
ctctgct |
240 |
Q |
| |
|
|| |||| |
|
|
| T |
50975166 |
ctttgct |
50975160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University