View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11893_low_16 (Length: 239)
Name: NF11893_low_16
Description: NF11893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11893_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 86 - 222
Target Start/End: Original strand, 39781198 - 39781334
Alignment:
| Q |
86 |
atctgagggcttcaacacaatcggtggaacggttcaatgcaaacaatgtggcttccaacgtgttctccaatttgatttgaaggaaaagtttgatgaagtt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39781198 |
atctgagggcttcaacacaatcggtggaacggttcaatgcaaacaatgtggcttccaacgtgttctccaatttgatttgaaggaaaagtttgatgaagtt |
39781297 |
T |
|
| Q |
186 |
gttgagttcattgaaaagaacaagtacaacatgcatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39781298 |
gttgagttcattgaaaagaacaagtacaacatgcatg |
39781334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 39600849 - 39600643
Alignment:
| Q |
12 |
gcagagacaataaacccaccattcccatgggccacttgcaaacgtgccaaagtttataccattcaccaattgctatctgagggcttcaacacaatcggtg |
111 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||| ||||||||||||||||||||||||||||| ||||||||| | |||||||||||||| ||| |
|
|
| T |
39600849 |
gcagagacaataaacccaccttttccatgggctacttgtaaacgtgccaaagtttataccattcaccacttgctatctaaaggcttcaacacaattagtg |
39600750 |
T |
|
| Q |
112 |
gaacggttcaatgcaaacaatgtggcttccaacgtgttctccaatttgatttgaaggaaaagtttgatgaagttgttgagttcattgaaaagaacaagta |
211 |
Q |
| |
|
||| |||| ||||| | |||| | || ||| | ||||| ||||||||||||| ||||||||| ||||||||||||||||||||||||| |||||| | |
|
|
| T |
39600749 |
gaaaggttgaatgcggaaaatgcgattttcaaagcgttcttgaatttgatttgaacgaaaagtttaatgaagttgttgagttcattgaaaacaacaagaa |
39600650 |
T |
|
| Q |
212 |
caacatg |
218 |
Q |
| |
|
| ||||| |
|
|
| T |
39600649 |
cgacatg |
39600643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 13 - 93
Target Start/End: Original strand, 39780152 - 39780232
Alignment:
| Q |
13 |
cagagacaataaacccaccattcccatgggccacttgcaaacgtgccaaagtttataccattcaccaattgctatctgagg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39780152 |
cagagacaataaacccaccattcccatgggccacttgcaaacgtgccaaagtttataccattcaccaattgctatctgagg |
39780232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University