View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11894_high_24 (Length: 355)

Name: NF11894_high_24
Description: NF11894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11894_high_24
NF11894_high_24
[»] chr8 (1 HSPs)
chr8 (15-112)||(4173727-4173824)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 8e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 15 - 112
Target Start/End: Original strand, 4173727 - 4173824
Alignment:
15 atgaaccgtatggagaacctccattagtgttttttatccaataagagaaaataatactttcaaatgtcgaaatgtacgtcaaaaatgtttttattatc 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
4173727 atgaaccgtatggagaacctccattagtgttttttatccaataagagaaaataatactttcaaatgtcgaaatgtatgtcaaaaatgtttttattatc 4173824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University