View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11894_high_24 (Length: 355)
Name: NF11894_high_24
Description: NF11894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11894_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 8e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 15 - 112
Target Start/End: Original strand, 4173727 - 4173824
Alignment:
| Q |
15 |
atgaaccgtatggagaacctccattagtgttttttatccaataagagaaaataatactttcaaatgtcgaaatgtacgtcaaaaatgtttttattatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4173727 |
atgaaccgtatggagaacctccattagtgttttttatccaataagagaaaataatactttcaaatgtcgaaatgtatgtcaaaaatgtttttattatc |
4173824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University