View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11894_high_28 (Length: 311)
Name: NF11894_high_28
Description: NF11894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11894_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 19 - 296
Target Start/End: Original strand, 7376891 - 7377174
Alignment:
| Q |
19 |
atagcccatgccaataatccttctggatggatttcctggtacccttttgtctggatggttttattttgaaggccgatggttgttgtcatgacgattcgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7376891 |
atagcccatgccaataatccttctggatggatttcctggtacccttttgtctggatggttttattttgaaggccgatggttgttgtcatgacgattcgaa |
7376990 |
T |
 |
| Q |
119 |
tagactttggtcgtctggttagaaaaggggatggtagttggatc-----atcagtactaatggtcactgaaggtttacaacatcatacacacatgaggtt |
213 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7376991 |
tagattttggtcgtctggttagaaaaggggatggtagttggatcatcagatcagtactaatggtcactgaaggtttacaacatcatacacacatgaggtt |
7377090 |
T |
 |
| Q |
214 |
tcttcctattttctgt-tttttaattattagagtataggatcagtctcaataaattaattacagttagtttgttaagaataaca |
296 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7377091 |
tcttcctattttctctgtttttaattattagagtataggatcagtctcaataaattaattacagttagtttgttaagaataaca |
7377174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University