View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11894_high_41 (Length: 209)
Name: NF11894_high_41
Description: NF11894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11894_high_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 27 - 160
Target Start/End: Complemental strand, 32596887 - 32596754
Alignment:
| Q |
27 |
ttcaagcaactaaacaaggagagagggtgagaccgtagaatggggtttccagcaaacattatccaacttggtattgagtagacttgacatattttgcaat |
126 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32596887 |
ttcaagcaactaaacaaggagacagggtgagaccgtagaatggggtttccagcaaacattatccaacttggtattgagtagacatgacatattttgcaat |
32596788 |
T |
 |
| Q |
127 |
gtattcttcaagtcgaactcaaaatataacaacg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32596787 |
gtattcttcaagtcgaactcaaaatataacaacg |
32596754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 132
Target Start/End: Complemental strand, 32667189 - 32667147
Alignment:
| Q |
90 |
caacttggtattgagtagacttgacatattttgcaatgtattc |
132 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
32667189 |
caactttgtattgtgtagacttgacatattttgtaatgtattc |
32667147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University