View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11894_high_42 (Length: 208)
Name: NF11894_high_42
Description: NF11894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11894_high_42 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 413852 - 414050
Alignment:
| Q |
1 |
aagtttgatgaaacaagtaatgagaatactaggaagtgtatttcaagggctggatgttcatccccgtcctttagcctcaaactaactgcaatggctgcaa |
100 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
413852 |
aagtttgatgaaataagtaataagaatactaggaagtgtatttcaagggctggatgttcatccccgtcctttagcctcaaactaactgc---------aa |
413942 |
T |
 |
| Q |
101 |
tggcggaagaggaagatgatgatgagcttgattccgaaatacaaacccggcctaaggacaatattaaagaatatcaaataaagtcggaacatatgccggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
413943 |
tggcggaagaggaagatgatgatgagcttgattccgaaatacaaagccggcctaaggacaatattaaagaatatcaaataaagtcggaacatatgccggt |
414042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 19 - 122
Target Start/End: Complemental strand, 37212350 - 37212247
Alignment:
| Q |
19 |
aatgagaatactaggaagtgtatttcaagggctggatgttcatccccgtcctttagcctcaaactaactgcaatggctgcaatggcggaagaggaagatg |
118 |
Q |
| |
|
||||||||| || |||||||||||||||| |||||||||||||||| ||||||||||||||||||||| | ||| | | ||||||| || |||||||| |
|
|
| T |
37212350 |
aatgagaatcatatgaagtgtatttcaaggactggatgttcatccccatcctttagcctcaaactaactcaactggtttccatggcgggagcggaagatg |
37212251 |
T |
 |
| Q |
119 |
atga |
122 |
Q |
| |
|
|||| |
|
|
| T |
37212250 |
atga |
37212247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 88
Target Start/End: Complemental strand, 37183896 - 37183841
Alignment:
| Q |
33 |
gaagtgtatttcaagggctggatgttcatccccgtcctttagcctcaaactaactg |
88 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| || ||||||||||||||||||| |
|
|
| T |
37183896 |
gaagtctatttcaagggctggatgtctatccccatcttttagcctcaaactaactg |
37183841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 88
Target Start/End: Complemental strand, 37195028 - 37194973
Alignment:
| Q |
33 |
gaagtgtatttcaagggctggatgttcatccccgtcctttagcctcaaactaactg |
88 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| || ||||||||||||||||||| |
|
|
| T |
37195028 |
gaagtctatttcaagggctggatgtctatccccatcttttagcctcaaactaactg |
37194973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 94
Target Start/End: Complemental strand, 37202968 - 37202906
Alignment:
| Q |
32 |
ggaagtgtatttcaagggctggatgttcatccccgtcctttagcctcaaactaactgcaatgg |
94 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||| || ||||| || |||||||||| ||||| |
|
|
| T |
37202968 |
ggaagtgtatttcaagggaaggatgttcgtccccatcttttagtctaaaactaactgaaatgg |
37202906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University