View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11894_high_42 (Length: 208)

Name: NF11894_high_42
Description: NF11894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11894_high_42
NF11894_high_42
[»] chr2 (1 HSPs)
chr2 (1-208)||(413852-414050)
[»] chr8 (4 HSPs)
chr8 (19-122)||(37212247-37212350)
chr8 (33-88)||(37183841-37183896)
chr8 (33-88)||(37194973-37195028)
chr8 (32-94)||(37202906-37202968)


Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 413852 - 414050
Alignment:
1 aagtttgatgaaacaagtaatgagaatactaggaagtgtatttcaagggctggatgttcatccccgtcctttagcctcaaactaactgcaatggctgcaa 100  Q
    ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||    
413852 aagtttgatgaaataagtaataagaatactaggaagtgtatttcaagggctggatgttcatccccgtcctttagcctcaaactaactgc---------aa 413942  T
101 tggcggaagaggaagatgatgatgagcttgattccgaaatacaaacccggcctaaggacaatattaaagaatatcaaataaagtcggaacatatgccggt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
413943 tggcggaagaggaagatgatgatgagcttgattccgaaatacaaagccggcctaaggacaatattaaagaatatcaaataaagtcggaacatatgccggt 414042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 19 - 122
Target Start/End: Complemental strand, 37212350 - 37212247
Alignment:
19 aatgagaatactaggaagtgtatttcaagggctggatgttcatccccgtcctttagcctcaaactaactgcaatggctgcaatggcggaagaggaagatg 118  Q
    |||||||||  || |||||||||||||||| |||||||||||||||| |||||||||||||||||||||  | ||| | | ||||||| || ||||||||    
37212350 aatgagaatcatatgaagtgtatttcaaggactggatgttcatccccatcctttagcctcaaactaactcaactggtttccatggcgggagcggaagatg 37212251  T
119 atga 122  Q
    ||||    
37212250 atga 37212247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 88
Target Start/End: Complemental strand, 37183896 - 37183841
Alignment:
33 gaagtgtatttcaagggctggatgttcatccccgtcctttagcctcaaactaactg 88  Q
    ||||| |||||||||||||||||||  |||||| || |||||||||||||||||||    
37183896 gaagtctatttcaagggctggatgtctatccccatcttttagcctcaaactaactg 37183841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 88
Target Start/End: Complemental strand, 37195028 - 37194973
Alignment:
33 gaagtgtatttcaagggctggatgttcatccccgtcctttagcctcaaactaactg 88  Q
    ||||| |||||||||||||||||||  |||||| || |||||||||||||||||||    
37195028 gaagtctatttcaagggctggatgtctatccccatcttttagcctcaaactaactg 37194973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 94
Target Start/End: Complemental strand, 37202968 - 37202906
Alignment:
32 ggaagtgtatttcaagggctggatgttcatccccgtcctttagcctcaaactaactgcaatgg 94  Q
    ||||||||||||||||||  |||||||| ||||| || ||||| || |||||||||| |||||    
37202968 ggaagtgtatttcaagggaaggatgttcgtccccatcttttagtctaaaactaactgaaatgg 37202906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University