View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11894_low_28 (Length: 319)
Name: NF11894_low_28
Description: NF11894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11894_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 304
Target Start/End: Complemental strand, 33501635 - 33501333
Alignment:
| Q |
1 |
agtcaccgacagtgttctggttttaacggtaaagctttaactcgaaaaagctcatacatacccttaatttgataatatcctcaatttaagtcaacaccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33501635 |
agtcaccgacagtgttctggttttaacggtaaagctttaactcgaaaaagctcatacatacccttaatttgataatatcctcaatttaagtcaacaccaa |
33501536 |
T |
 |
| Q |
101 |
ggttttcagtcaccgcgatttatgatattgccgaaaattgttgttaaatattagcgattacagagcagttggaaacatatagaaccctgacgttgcgacc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33501535 |
ggttttcagtcaccacgatttatgatattgccgaaaattgttgttaaatattagcgattacagagcagttggaaacatatagaaccctgacgttgcgacc |
33501436 |
T |
 |
| Q |
201 |
gcaattgtggtcacagaannnnnnnnnctttcgaacaccgacaaattagtgtttaatgtcatggtttgcctaaaaaagtgtctaggttaggatgtattat |
300 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33501435 |
gcaattgtggtcacagaa-ttttttttctttcgaacaccgacaaattagtgtttaatgttatggtttgcctaaaaaagtgtctagattaggatgtattat |
33501337 |
T |
 |
| Q |
301 |
aatt |
304 |
Q |
| |
|
|||| |
|
|
| T |
33501336 |
aatt |
33501333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University