View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11894_low_32 (Length: 299)
Name: NF11894_low_32
Description: NF11894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11894_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 10 - 281
Target Start/End: Complemental strand, 26611112 - 26610840
Alignment:
| Q |
10 |
gcagagaaagtttatgcatgtgtgttgtgtacagagtgaaaaatattaatttaa-gttttaatttgaccttactccttttcctatgccgtgtcttttgtt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26611112 |
gcagagaaagtttatgcatgtgtgttgtgtacagagtgaaaaatattaatttaaagttttaatttgaccttactccttttcctatgccgtgtcttttgtt |
26611013 |
T |
|
| Q |
109 |
ggttaattatattttgattacagacacatgtgcttgagtaattaactcaaccaatcatattactctttttattgctttatgatgggaccatagtatatcc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26611012 |
ggttaattatattttgattacagacacatgtgcttgagtaattaactcaaccaatcatattactctttttattgctttatgatgggaccatagtatatcc |
26610913 |
T |
|
| Q |
209 |
caccacatgaccccaaatccattaatcataagctattacagaacaaatccaccaaaataacacagggcagtta |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26610912 |
caccacatgaccccaaatccattaatcataagctattacagaacaaatccaccaaaataacacagggcagtta |
26610840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University