View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11894_low_42 (Length: 225)
Name: NF11894_low_42
Description: NF11894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11894_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 3 - 204
Target Start/End: Original strand, 4865839 - 4866040
Alignment:
| Q |
3 |
gtttccatgccattttcactcagcacggtcgtgcgcatcttttgtctggttgtgcgtccctgattggtgtggttgtgcgcaggaacaatgagtgacatgc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
4865839 |
gtttccatgccattttcactcagcacggtcgtgcgcatcttttgtctggtcgtgcgtccctgattggtgtggttgtgcgcaggaacaacgattgacatgc |
4865938 |
T |
|
| Q |
103 |
acggaccctgcgccttacctgcacgatcgtgcgtcccttcataggctcatttttggacgttttgaacaataagttggaagcaagtccaggtgatacaaga |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4865939 |
acggaccctgcgccttacccgcacgatcgtgcgtcccttcataggctcatttttggacgttttgaacaataagttggaagcaagtccaggtgatacaaga |
4866038 |
T |
|
| Q |
203 |
ac |
204 |
Q |
| |
|
|| |
|
|
| T |
4866039 |
ac |
4866040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 201
Target Start/End: Complemental strand, 17039435 - 17039403
Alignment:
| Q |
169 |
caataagttggaagcaagtccaggtgatacaag |
201 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
17039435 |
caataggttggaagcaagtccaggtgatacaag |
17039403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University