View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11894_low_47 (Length: 208)
Name: NF11894_low_47
Description: NF11894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11894_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 21 - 192
Target Start/End: Complemental strand, 50749522 - 50749356
Alignment:
| Q |
21 |
atggatataccg--atcattttaattttatcatattatttatagatatgttatcgtgctattaacttgatgttgtgagtttattcacatgtttaatttta |
118 |
Q |
| |
|
|||||||||||| | |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50749522 |
atggatataccgcgaccattttgattttatcatattatttatagatatgttatcgtgctattaa-------ttgtgagtttattcacatgtttaatttta |
50749430 |
T |
 |
| Q |
119 |
aatatttttacaatgtttatgtggttgcaataaagaaatcggagggagattgaacattgtttaacatttgaatt |
192 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50749429 |
aatatttttacaatgtttacgtggttgcaataaagaaatcggagggagattgaacattgtttaacatttgaatt |
50749356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 62
Target Start/End: Original strand, 45393277 - 45393305
Alignment:
| Q |
34 |
tcattttaattttatcatattatttatag |
62 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45393277 |
tcattttaattttatcatattatttatag |
45393305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 33 - 66
Target Start/End: Complemental strand, 31802406 - 31802373
Alignment:
| Q |
33 |
atcattttaattttatcatattatttatagatat |
66 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
31802406 |
atcactttaattttatcatattatttatagatat |
31802373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 61
Target Start/End: Original strand, 5546499 - 5546527
Alignment:
| Q |
33 |
atcattttaattttatcatattatttata |
61 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5546499 |
atcattttaattttatcatattatttata |
5546527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University