View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11895_low_23 (Length: 232)
Name: NF11895_low_23
Description: NF11895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11895_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 19377537 - 19377732
Alignment:
| Q |
18 |
gaaactaaaatcaaatttttattaaattaagctaatattaacaaatgataatcataacaacgaaataacaacaaacaccaaatcccaacaatttctccnn |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19377537 |
gaaactaaaatcaaatttttattaa-----gctaatattaacaaatgataatcataacaacgaaataacaacaaacaccaaatcccaacaatttctcctt |
19377631 |
T |
|
| Q |
118 |
nnnnnnnnnnnnnnngtaagaaaaaacaaacaaccaaaccaatcacaaccccgaaattacaacaatacccttgattcattcagatcttattcagcttctc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19377632 |
ttttgttttgtttttgtaagaaaaaacaaacaaccaaaccaatcacaaccccgaaattacaacaatacccttgattcattcagatcttattcagcttctc |
19377731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University