View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11896_high_16 (Length: 287)
Name: NF11896_high_16
Description: NF11896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11896_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 8 - 271
Target Start/End: Original strand, 42233837 - 42234094
Alignment:
| Q |
8 |
tagcataggctctaatatttatcttcaaatttgggttgagcacacgacacactcttgcaaagtaaagattacatctatttataaacacatgaatatgctc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42233837 |
tagcataggctctaatatttatcttcaaatttgggttgagcacacgacacactcttgcaaagtaaagactacatctatttataaacacatgaatatgctc |
42233936 |
T |
|
| Q |
108 |
atatcatatttaaatttttgttggcaatagctggataggtgaaacagaaaaacaattattccctagaaaaggcaacnnnnnnnnnnnnnnnnnnnntaca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42233937 |
atatcatatttaaatttttgttggcaatagatggataggtgaaacagaaaaacaattattccctagaaaaggcaac------aaaaaaaaaacaaataca |
42234030 |
T |
|
| Q |
208 |
cgggcccacgacgtgaaggagttttctgttgaattgaagtatatgttctttggaaggttacatg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42234031 |
cgggcccacgacgtgaaggagttttctgttgaattgaagtatatgttctttggaaggttacatg |
42234094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University