View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11896_low_18 (Length: 293)
Name: NF11896_low_18
Description: NF11896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11896_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 4 - 280
Target Start/End: Original strand, 31881354 - 31881630
Alignment:
| Q |
4 |
gatggacatcaccatgatctccttcggatgtttaggaaccgtaagtggaccacactcctaagcccttacacgaagatcaacattggcctcttaaaagagt |
103 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31881354 |
gatggccatcaccatgatctccttcagatgtttaggaaccgtaggtggaccacactcttaagcccttacacgaagatcaacattggcctcttaaaggagt |
31881453 |
T |
 |
| Q |
104 |
tttatgccaatgttgtaaccgatgcctcccacactaccatggccgactccttttctttcaccaccaccgtgaggggaaagaccatccgcttcaataggga |
203 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31881454 |
tttattccaatgttgtaaccgatgcctcccacactaccatggccgactccttttctttcaccaccaccgtgaggggaaagaccatccgcttcgataggga |
31881553 |
T |
 |
| Q |
204 |
tgcgatcaatgacttccttggtaaaccttttacccttcctgagtcggaggaaccaactgtacccactctctatgcct |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31881554 |
tgcgatcaatgacttccttggtaaaccttttaccctacctaagtcggaggaaccaactgtacccactctctgtgcct |
31881630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University