View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11896_low_20 (Length: 276)
Name: NF11896_low_20
Description: NF11896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11896_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 10759871 - 10759669
Alignment:
| Q |
1 |
catgcatatcaactcacttaaatatgtaaataaaa-tctaaatacgcattttggtaattggtatatattaatctaaatatatatgtgcaatgtataactt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
10759871 |
catgcatatcaactcacttaaatatgtaaataaaaatctaaatacgcattttggtaatc--tatatat--------atatatatgcgcaatgtataactt |
10759782 |
T |
 |
| Q |
100 |
ttcgtaaatgatatcaagtgaaaataatagtctttggatttaaaatcgggggtcaagattagaaggctcattatctctactgtatatgggtttttcaaat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10759781 |
ttcgtaaatgatatcaagtgaaaataatagtctttggatttaaaatcgggggtcaagattagaaggctcattatctctactgtatatgggtttttcaaat |
10759682 |
T |
 |
| Q |
200 |
tctagaatttttg |
212 |
Q |
| |
|
|| | |||||||| |
|
|
| T |
10759681 |
tccaaaatttttg |
10759669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University