View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11896_low_27 (Length: 235)
Name: NF11896_low_27
Description: NF11896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11896_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 42560396 - 42560615
Alignment:
| Q |
1 |
tcaatcacttatgacaaatggttagagtataacaccnnnnnnnccttattaattgttatggcgtaagtcaagatctacatgataa-ttaatcaggttttt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42560396 |
tcaatcacttatgacaaatggttagagtataacacctttttttccttattaattgttatggcgtaagtcaagatctacatgataaattaatcaggttttt |
42560495 |
T |
 |
| Q |
100 |
tgcttaatcgagcggaagggagggaaggtaatgatttttattttggtttgcaaggtgaggggctggattctaaaaaggaaaatggttaattttcttttta |
199 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42560496 |
tgcttaatcgaggggaggggagggaaggtaatgatttttattttggtttgcaaggtgaggggctggattctaaaaaggaaaatggttaattttcttttta |
42560595 |
T |
 |
| Q |
200 |
ggtcctaatgtgtttcattt |
219 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
42560596 |
ggtcctaatgtgcttcattt |
42560615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University