View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11896_low_30 (Length: 206)
Name: NF11896_low_30
Description: NF11896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11896_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 31306534 - 31306341
Alignment:
| Q |
1 |
aagatatattgaataaacttacttgctgctgctccttagccatgtgttggctaacagatgtctgcagagctcctgtgcaggatgctaactcccttcggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31306534 |
aagatatattgaataaacttacttgctgctgctccttagccatgtgttggctaacagatgtctgcagagctcctgtgcaggatgctaactcccttcggaa |
31306435 |
T |
|
| Q |
101 |
actttcatcattgtcaccggaagagtttaaaagctcaaataaatggtcaaagaggttgctttcccccttgtgttcaagagaatatgtctctgct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31306434 |
actttcatcattgtcaccggaagagtttaaaagctcaaataaatggtcaaagaggttgctttcccccttgtgttcaagagaatatgtctgtgct |
31306341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 33 - 184
Target Start/End: Complemental strand, 43982790 - 43982639
Alignment:
| Q |
33 |
tccttagccatgtgttggctaacagatgtctgcagagctcctgtgcaggatgctaactcccttcggaaactttcatcattgtcaccggaagagtttaaaa |
132 |
Q |
| |
|
||||| |||| |||||| ||||| |||||||| | |||||||||||| ||||| || || ||| | |||| |||||||| | |||||| ||||| | |
|
|
| T |
43982790 |
tcctttgccaggtgttgactaactgatgtctgtaaagctcctgtgcaagatgccaattctcttggaaaaccctcatcattcttggtggaagaatttaaga |
43982691 |
T |
|
| Q |
133 |
gctcaaataaatggtcaaagaggttgctttcccccttgtgttcaagagaata |
184 |
Q |
| |
|
||||||||| ||| ||||| || |||||||| |||||||| ||||||||||| |
|
|
| T |
43982690 |
gctcaaatagatgatcaaaaagattgctttcacccttgtgctcaagagaata |
43982639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University