View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11896_low_6 (Length: 516)

Name: NF11896_low_6
Description: NF11896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11896_low_6
NF11896_low_6
[»] chr1 (2 HSPs)
chr1 (286-407)||(1237748-1237869)
chr1 (453-503)||(1237868-1237918)


Alignment Details
Target: chr1 (Bit Score: 114; Significance: 1e-57; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 286 - 407
Target Start/End: Original strand, 1237748 - 1237869
Alignment:
286 aaatgagataggaatgtcgttggctacaaacatcttaacaagttcattttggcaagcttcttggtcaaacttgttaaatttctgccttttgcttccatca 385  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||    
1237748 aaatgagataggaatgtcgttggctacaaacatcttaacaagttcattttggcaagcttcttggtcaaacttgttagatttttgccttttgcttccatca 1237847  T
386 ctttgctcatctgtaaagtgat 407  Q
    ||||||||||||||||||||||    
1237848 ctttgctcatctgtaaagtgat 1237869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 453 - 503
Target Start/End: Original strand, 1237868 - 1237918
Alignment:
453 atacacaagtagtgttagagccaaatggtggagtagaaaactgattctctg 503  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
1237868 atacacaagtagtgttagagccaaatggtggagtagaaaactgattctctg 1237918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University