View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11897_high_24 (Length: 339)

Name: NF11897_high_24
Description: NF11897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11897_high_24
NF11897_high_24
[»] chr1 (1 HSPs)
chr1 (281-316)||(25522470-25522505)


Alignment Details
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 316
Target Start/End: Original strand, 25522470 - 25522505
Alignment:
281 ttatgatctccttcatttgcaaaaacaaatatgata 316  Q
    ||||||||||||||||||||||||||||||||||||    
25522470 ttatgatctccttcatttgcaaaaacaaatatgata 25522505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University