View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11897_high_28 (Length: 312)
Name: NF11897_high_28
Description: NF11897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11897_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 13 - 294
Target Start/End: Complemental strand, 916791 - 916498
Alignment:
| Q |
13 |
agatgaatgaaagataccctactcattactcaagtacaacgttgatgtctttttgggcgtcacttctttctactatgtttgctctatgctttgatagaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
916791 |
agatgaatgaaagataccctactcattactcaagtacaacgttgatgtctttttgggcgtcacttctttctactatgtttgctctatgctttgatagaga |
916692 |
T |
|
| Q |
113 |
tttgagtcagtggagattgggttggaatattaggctactaattgttgcttatgcggtatgtttaaatgttcattgctatagttaatagcaat------ga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
916691 |
tttgagtcagtggagattgggttggaatattaggctactaattgttgcttatgcggtatgtttaaatgttcattgctatagttaatagcaatgatgaaga |
916592 |
T |
|
| Q |
207 |
aaaactaataaaaaagagaataatgaaaacaatgt------ttaaatctttattgattagtactccatgtgaattgggtggtgcagggtatagt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
916591 |
aaaactaataaaaaagagaataatgaaaacaatgtttaaaattaaatctttattgattagtactccatgtgaattgggtggtgcagggtatagt |
916498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 15 - 174
Target Start/End: Complemental strand, 1236765 - 1236606
Alignment:
| Q |
15 |
atgaatgaaagataccctactcattactcaagtacaacgttgatgtctttttgggcgtcacttctttctactatgtttgctctatgctttgatagagatt |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||||| |||| | | || |||||||||||||||| ||||||| |
|
|
| T |
1236765 |
atgagtgaaagataccctactcattactcaagcacagcgttgatatctttttgggcgtcacttgtttccattgtgcttgctctatgctttgagagagatt |
1236666 |
T |
|
| Q |
115 |
tgagtcagtggagattgggttggaatattaggctactaattgttgcttatgcggtatgtt |
174 |
Q |
| |
|
|||||||||||| |||||||||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
1236665 |
tgagtcagtggaaattgggttggaatattagacttctaacagttgcttatgcggtatgtt |
1236606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University