View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11897_high_32 (Length: 281)
Name: NF11897_high_32
Description: NF11897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11897_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 84 - 263
Target Start/End: Original strand, 32894077 - 32894257
Alignment:
| Q |
84 |
ttttgtgttctctcaaaatctgagcatgatgtgtcaaattcccatggcgtcaatctgtaatagcatcaccttcttcctttcctttctttgttgttcgatg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32894077 |
ttttgtgttctctcaaaatctgagcatgatgtgtcaaattcccatggcgtcaatctgtaatagcatcaccttcttcctttcctttctttgttgctcgatg |
32894176 |
T |
 |
| Q |
184 |
gtgatgtattagattggatggat-ggatgggatggctgaatgagttttacatcattcatgttttaattaatcctactcgtt |
263 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
32894177 |
gtgatgtattagattggatggatgggatgtgatggctgaatgagttttacttaattcatgttttaattaatcctactcgtt |
32894257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 32893989 - 32894051
Alignment:
| Q |
1 |
gatggaggagaagacctcagcatgcagattgaagagatgatttgatttgatgtaaagcctgat |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32893989 |
gatggaggagaagacctcagcatgcagattgaagagatgatttgatttgatgtaaagcctgat |
32894051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University