View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11897_low_27 (Length: 318)
Name: NF11897_low_27
Description: NF11897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11897_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 46 - 301
Target Start/End: Complemental strand, 40574063 - 40573811
Alignment:
| Q |
46 |
aatcatagtgttgcaaagaatatgatacagatacaatccgttaacttttgtggagaattgagggtgcttacagatgaagaatgtgaggaatgattccatc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40574063 |
aatcatagtgttgcaaagaatatgatacagatacaatccgttaacttttgtggagaattgagagtgcttacagatgaagaatgtgaggaatgattccatc |
40573964 |
T |
 |
| Q |
146 |
agcaatagactttttggcagtggaatcaaatgcttctttgtaactagtctcttttccttcaaattcaagaaaacggaaattgtgagaatcatgatgataa |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40573963 |
agcaatagactttttggcagtggaatcaaatgcttctttgtaactagtctcttttccttcaaattcaagaaaacggaaattgtgagaatca---tgataa |
40573867 |
T |
 |
| Q |
246 |
tcatgattaaaatcataagaaattagaaactccttaccagcatccattgcaaattt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40573866 |
tcatgattaaaatcataagaaattagaaactccttaccagcatccattgcaaattt |
40573811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University