View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11897_low_31 (Length: 293)
Name: NF11897_low_31
Description: NF11897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11897_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 13 - 190
Target Start/End: Original strand, 15181909 - 15182086
Alignment:
| Q |
13 |
aatttatactatttgcgaaatatatgcttcgtaagcagaacagaaaacctggggtaggaaacgtttaggatcgttgtttttcaaaacatagtacttaatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15181909 |
aatttatactatttgcgaaatatatgcttcgtaagcagaacagaaaacctggggtaggaaacgtttaagatcgttgtttttcaaaacatagtacttaatt |
15182008 |
T |
|
| Q |
113 |
atttaaccaaaaatcaataattaaataagtagtaatcatgacata-tttttttctcttcaacgggacgtaaaatgacag |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
15182009 |
atttaaccaaaaatcaataattaaataagtaggaatcatgacatattttttttctcttcaacgggac-taaaatgacag |
15182086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 214 - 283
Target Start/End: Original strand, 15182072 - 15182141
Alignment:
| Q |
214 |
ggactaaaatgacagttgcttgatagcaaaaacaatgatatctcctctaaacatatgataattcatctca |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||| |
|
|
| T |
15182072 |
ggactaaaatgacagttgcttgatagcaaaaacgatgatagctcctctaaacatatgataattcagctca |
15182141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University