View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11897_low_32 (Length: 288)
Name: NF11897_low_32
Description: NF11897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11897_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 29596225 - 29595960
Alignment:
| Q |
1 |
agatgaaatgagtaggcaacaaactgcttg-gcatgtttgaatacaacacatgacggcgcatctcatattcatgatcaacacacttatctacttactagt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29596225 |
agatgaaatgagtaggcaacaaactgcttgagcatgttagaatacaacacatgacggcgcatctcatgttcatgatcaacacacttatctacttactagt |
29596126 |
T |
 |
| Q |
100 |
nnnnnnntcttatactacaagtctgtttggatccacggtggggctctgcagacgcgcggtttttcgaagcatcaaatactagcttcgcaattatcacaat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||| |||| || |
|
|
| T |
29596125 |
aaaaaaatcttatactacaagtctgtttggatccacggtggggctatgcagacacgcggtttttcgaagcaccaaatactagcttcgcaattttcacgat |
29596026 |
T |
 |
| Q |
200 |
tagtggtttgttagtcgcgtgtttgatgtaagaaaattcgggaatcaaacacatactacaacattg |
265 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
29596025 |
tagtggtatgttagacgcgtgtttgatgtaagaagattcgggaatcaaacacatactaaaacattg |
29595960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University