View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11897_low_35 (Length: 268)
Name: NF11897_low_35
Description: NF11897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11897_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 7 - 143
Target Start/End: Complemental strand, 34007646 - 34007510
Alignment:
| Q |
7 |
tacacgtcacctggaggtcccaaggtgccagaagctgcaatgaacatacaacaactttatgattactaaaacaactttatcccggtgcaatttcaaaaac |
106 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34007646 |
tacacgtcacctggaggtgccacggtgccagaacctgcaatgaacatacaacaactttatgattactaaaacaactttatcccggtgaaatttcaaaaac |
34007547 |
T |
 |
| Q |
107 |
taatatactaaatgcaaatatcattttaaaaagtaaa |
143 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34007546 |
taatatactaattgcaaatatcattttaaaaagtaaa |
34007510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 183 - 263
Target Start/End: Original strand, 55353632 - 55353712
Alignment:
| Q |
183 |
cgataggtggggtagtttaagaggtggcagggactattgtagttggtgtttgctgttttttggctgtgcctctctgcttct |
263 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
55353632 |
cgataggtggggtagtttcagaggtggcagggactattgtagttggtgtttgctgttttttggttgtgcctttctgcttct |
55353712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 186 - 263
Target Start/End: Original strand, 44346553 - 44346630
Alignment:
| Q |
186 |
taggtggggtagtttaagaggtggcagggactattgtagttggtgtttgctgttttttggctgtgcctctctgcttct |
263 |
Q |
| |
|
||||||||| ||||| ||||||| ||||||| ||| |||||||||||||||||||| || ||||||| ||||||||| |
|
|
| T |
44346553 |
taggtggggaagtttcagaggtgttagggacttttgcagttggtgtttgctgtttttcggttgtgcctttctgcttct |
44346630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University