View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11897_low_35 (Length: 268)

Name: NF11897_low_35
Description: NF11897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11897_low_35
NF11897_low_35
[»] chr5 (1 HSPs)
chr5 (7-143)||(34007510-34007646)
[»] chr4 (1 HSPs)
chr4 (183-263)||(55353632-55353712)
[»] chr7 (1 HSPs)
chr7 (186-263)||(44346553-44346630)


Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 7 - 143
Target Start/End: Complemental strand, 34007646 - 34007510
Alignment:
7 tacacgtcacctggaggtcccaaggtgccagaagctgcaatgaacatacaacaactttatgattactaaaacaactttatcccggtgcaatttcaaaaac 106  Q
    |||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
34007646 tacacgtcacctggaggtgccacggtgccagaacctgcaatgaacatacaacaactttatgattactaaaacaactttatcccggtgaaatttcaaaaac 34007547  T
107 taatatactaaatgcaaatatcattttaaaaagtaaa 143  Q
    ||||||||||| |||||||||||||||||||||||||    
34007546 taatatactaattgcaaatatcattttaaaaagtaaa 34007510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 183 - 263
Target Start/End: Original strand, 55353632 - 55353712
Alignment:
183 cgataggtggggtagtttaagaggtggcagggactattgtagttggtgtttgctgttttttggctgtgcctctctgcttct 263  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||    
55353632 cgataggtggggtagtttcagaggtggcagggactattgtagttggtgtttgctgttttttggttgtgcctttctgcttct 55353712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 186 - 263
Target Start/End: Original strand, 44346553 - 44346630
Alignment:
186 taggtggggtagtttaagaggtggcagggactattgtagttggtgtttgctgttttttggctgtgcctctctgcttct 263  Q
    ||||||||| ||||| |||||||  ||||||| ||| |||||||||||||||||||| || ||||||| |||||||||    
44346553 taggtggggaagtttcagaggtgttagggacttttgcagttggtgtttgctgtttttcggttgtgcctttctgcttct 44346630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University