View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11897_low_36 (Length: 242)
Name: NF11897_low_36
Description: NF11897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11897_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 40574094 - 40574325
Alignment:
| Q |
1 |
gacatatggttagatttaattacattcattttaatcaaattattattgatatctaattgttagttagtgtcatgactcaatgtcttaggtttgatccccc |
100 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40574094 |
gacatatggttacatttaattactttcattttaatcaaattattattgatatctaattgttagttagtgtcatgactcaatgtcttaggtttgatccccc |
40574193 |
T |
 |
| Q |
101 |
ttgccaatttcggtgggctagtccattaaacggctccctcaagtagactgtgagattgaacccctcagattagtcagtctttggcccctgagttttcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40574194 |
ttgccaatttcggtgggctagtccattaaacggctccctcaagtagactgtgagattgaacccctcagattagtcagtctttggcccctgagttttcaaa |
40574293 |
T |
 |
| Q |
201 |
acaaacaaaagacgtgttagtgtgatgtccat |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |
|
|
| T |
40574294 |
acaaacaaaagacgtgttagtgtcatgtccat |
40574325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 126
Target Start/End: Original strand, 39012345 - 39012398
Alignment:
| Q |
76 |
ctcaatgtcttaggtttgatccccct---tgccaatttcggtgggctagtccat |
126 |
Q |
| |
|
||||| |||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
39012345 |
ctcaaggtcttaggtttgattcccctcggtgccaatttcggtgggctagtccat |
39012398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University