View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11898_high_14 (Length: 265)
Name: NF11898_high_14
Description: NF11898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11898_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 30687657 - 30687472
Alignment:
| Q |
18 |
atcagcaacctttcaaaggatattggttagttcttctgtcaatttcctccttactctcatattgcaccaagagttagcaaatatgaatgtcacttatcaa |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30687657 |
atcagcaacctttcaaaagatattggttagttct---gtcaatttcctcctaactctcatattgcaccaagagttagcaaatatgaatgtcacttatcaa |
30687561 |
T |
 |
| Q |
118 |
gtattaatgtttctgatgcgcccttgcaaattaatgcaactaatctaatactacataagcgcagnnnnnnncaacctaatgcaacacga |
206 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30687560 |
gtattaatgtttctgatgtgcccttgcaaattaatgcaactaatctaatactacataagcgcagaaaaaaacaacctaatgcaacacga |
30687472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University