View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11898_high_19 (Length: 218)
Name: NF11898_high_19
Description: NF11898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11898_high_19 |
 |  |
|
| [»] scaffold0110 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0110 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 15 - 198
Target Start/End: Original strand, 5770 - 5953
Alignment:
| Q |
15 |
cagagacaagtgcgttgttttaaaagagaaacatttgggacttgtttgtgtggcttccctttgagacttttatgagcttcataagatatttatgaacacc |
114 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5770 |
cagagacaaatgcgttgttttaaaagagaaacatttgggacttgtttgtgtggcttccctttgagacttttatgagcttcataagatatttatgaacacc |
5869 |
T |
 |
| Q |
115 |
ttactttatatccatatatgttctattgtctacatttaatgtggtgaggtggtagagaattgttgttagataaattattccaag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5870 |
ttactttatatccatatatgttctattgtctacatttaatgtggtgaggtggtagagaattgttgttagttaaattattccaag |
5953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University