View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11898_low_18 (Length: 236)
Name: NF11898_low_18
Description: NF11898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11898_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 69 - 220
Target Start/End: Original strand, 4609617 - 4609768
Alignment:
| Q |
69 |
cgagaacagtggcttatattaacatgttgcatgagtctcctacggatcttacagaaaagttggaccctataaagcaagtcaacatccttataatcttttt |
168 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4609617 |
cgagaacagtcgcttatattaacatgttgcatgagtctcctacggatcttacagaaaagttggaccctataaagcaagtcaacatccttataatcttttt |
4609716 |
T |
 |
| Q |
169 |
gagataaacaacaatgttgtactttttaacttatagtcttttcgagataaac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4609717 |
gagataaacaacaatgttgtactttttaacttataatcttttcgagataaac |
4609768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 4609746 - 4609788
Alignment:
| Q |
155 |
cttataatctttttgagataaacaacaatgttgtactttttaa |
197 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4609746 |
cttataatcttttcgagataaacaacaatgttgtactttttaa |
4609788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University