View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11898_low_20 (Length: 227)
Name: NF11898_low_20
Description: NF11898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11898_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 32096577 - 32096797
Alignment:
| Q |
1 |
tctgacggttacgtgtttcaagatcttgtagctttcttcttagctgtttcaagtactcaatagtgtcacctaatatagaagccttgtccatttttgtcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096577 |
tctgacggttacgtgtttcaagatcttgtatctttcttcttagctgtttcaagtactcaatagtgtcacctaatatagaagccttgtccatttttgtcac |
32096676 |
T |
 |
| Q |
101 |
gaatggaaccaatgagcttaaaataatgaacctctcattgagtttctctcttcttcgtcgctccgcgaggacatggttggcgctcagctcgtcttgcggt |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096677 |
gaatggaaccaatgatcttaaaataatgaacctttcattgagtttctctcttcttcgtcgctccgcgaggacatggttggcgctcagctcgtcttgcggt |
32096776 |
T |
 |
| Q |
201 |
gttcccttgccgcgtaacttg |
221 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
32096777 |
gttcccttgccacgtaacttg |
32096797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University