View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11899_low_5 (Length: 256)
Name: NF11899_low_5
Description: NF11899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11899_low_5 |
 | |
|
| [»] chr3 (5 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 8e-70; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 123 - 256
Target Start/End: Original strand, 47350604 - 47350737
Alignment:
| Q |
123 |
taatgggacgttaaaaaatgaacaaactgtgaccttcaactaaaacaatgttggaagagagtggtttcttcaagagccatcatactaacttcagctaagc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47350604 |
taatgggacgttaaaaaatgaacaaactgtgaccttcaactaaaacaatgttggaagagagtggtttcttcaagagccatcatactaacttcagctaagc |
47350703 |
T |
|
| Q |
223 |
gtagctcatgaatcccagctccaatgaaaatgcc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47350704 |
gtagctcatgaatcccagctccaatgaaaatgcc |
47350737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 47350117 - 47350230
Alignment:
| Q |
1 |
agggtccagtttgggatgagattgtgaaggagaacgagcttcaacctacgaagttggaagaagttgctgagtggtgggttgcggatgctacttttggaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47350117 |
agggtccagtttgggatgagattgtgaaggagaacgagcttcaacctacgaagttggaagaagttgctgagtggtgggttgcggatgctacttttggaat |
47350216 |
T |
|
| Q |
101 |
ggaagacattgtag |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47350217 |
ggaagacattgtag |
47350230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 3818766 - 3818669
Alignment:
| Q |
1 |
agggtccagtttgggatgagattgtgaaggagaacgagcttcaacctacgaagttggaagaagttgctgagtggtgggttgcggatgctacttttgga |
98 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | | | || |||||| ||||||||||||||||||||||| |||| |||||| ||||||| |
|
|
| T |
3818766 |
agggtcctgtttgggatgagattgtgaaggagaatgggttgcaggtaacgaagctggaagaagttgctgagtggtggtttgcagatgcttgttttgga |
3818669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 47339111 - 47339208
Alignment:
| Q |
1 |
agggtccagtttgggatgagattgtgaaggagaacgagcttcaacctacgaagttggaagaagttgctgagtggtgggttgcggatgctacttttgga |
98 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| | | | || |||||| ||||||||||||||||||||||| |||| |||||| ||||||| |
|
|
| T |
47339111 |
agggtcctgtttgggatgagattgtgaaggagaatgggttgcaggtgacgaagctggaagaagttgctgagtggtggtttgcagatgcttgttttgga |
47339208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 47347581 - 47347614
Alignment:
| Q |
1 |
agggtccagtttgggatgagattgtgaaggagaa |
34 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
47347581 |
agggtcctgtttgggatgagattgtgaaggagaa |
47347614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University