View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11900_low_23 (Length: 206)
Name: NF11900_low_23
Description: NF11900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11900_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 25 - 183
Target Start/End: Complemental strand, 37248378 - 37248219
Alignment:
| Q |
25 |
gtggtggtccattgccgcgtgaaaaaactctgtgtgaaaattgtggtgttgctggtggtatgaatgttatcaatggtgtgttgttttcattttggttttt |
124 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37248378 |
gtggtggtccattgcggcgtgaaaaaactcttcgtgaaaattgtggtgttgctggtggtatgaatgttgtcaatggtgtgttgttttcattttggttttt |
37248279 |
T |
|
| Q |
125 |
caccattttcagtgatgagcaaatgagtgttgagagaattgg-ttttagaagaagatagg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37248278 |
caccattttcagtgatgagcaaatgagtgttgagagaattggtttttagaagaagatagg |
37248219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 27 - 183
Target Start/End: Complemental strand, 37238684 - 37238528
Alignment:
| Q |
27 |
ggtggtccattgccgcgtgaaaaaactctgtgtgaaaattgtggtgttgctggtggtatgaatgttatcaatggtgtgttgttttcattttggtttttca |
126 |
Q |
| |
|
||||||||||||| || ||||| |||| |||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
37238684 |
ggtggtccattgcgacgcaaaaaagctcttcgtgaaaatcgtggtgttgctggtggtatgaatgatgtcaatggtgtgttgttttcattttggtttttca |
37238585 |
T |
|
| Q |
127 |
ccattttcagtgatgagcaaatgagtgttgagagaattggttttagaagaagatagg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37238584 |
ccattttcagtgatgagcaaatgagtgttgagagaattggttttagaagaagatagg |
37238528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University