View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_high_33 (Length: 327)
Name: NF11901_high_33
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_high_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 204
Target Start/End: Complemental strand, 31576064 - 31575880
Alignment:
| Q |
20 |
gagtcaacactgcggtgactgataatggtagtactaaaaggaaagggatgtgcatttctttgttaaatatgcttttctcgattgctgggaactgaaaaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31576064 |
gagtcaacactgcggtgactgataatggtagtactaaaaggaaagggatgtgcatttctttgttaaatatgcttttctcgattgctgggaactgaaaaat |
31575965 |
T |
|
| Q |
120 |
aacattgagttgaagtaacccaaaacatgaattgacaactgaggttgataacactacaccatagcaccatccttgtggaataagc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31575964 |
aacattgagttgaagtaacccaaaacatgaattgacaactgaggttgataacactacaccatagcaccatccttgtggaataagc |
31575880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 234 - 277
Target Start/End: Complemental strand, 31575849 - 31575806
Alignment:
| Q |
234 |
caagcaaggaaggttgagggcacagttattaggcatgcactgca |
277 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31575849 |
caagcaaggaaggttgagggcacagttactaggcatgcactgca |
31575806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 287 - 322
Target Start/End: Complemental strand, 31575813 - 31575778
Alignment:
| Q |
287 |
gcactgcatagaaattctaaaccagtctctgcttct |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31575813 |
gcactgcatagaaattctaaaccagtctcttcttct |
31575778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University