View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11901_high_39 (Length: 276)

Name: NF11901_high_39
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11901_high_39
NF11901_high_39
[»] chr5 (1 HSPs)
chr5 (20-128)||(8792884-8792992)


Alignment Details
Target: chr5 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 20 - 128
Target Start/End: Complemental strand, 8792992 - 8792884
Alignment:
20 caaatcaacttccctacatcaaaaggaactaatgcagtcccttgcgattgcaatggcttatgcaacacgattctttgagaaggaatggtgaagcaaaagg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8792992 caaatcaacttccctacatcaaaaggaactaatgcagtcccttgcgattgcaatggcttatgcaacacgattctttgagaaggaatggtgaagcaaaagg 8792893  T
120 tcttctctg 128  Q
    |||||||||    
8792892 tcttctctg 8792884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University