View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_high_45 (Length: 254)
Name: NF11901_high_45
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 37241497 - 37241271
Alignment:
| Q |
19 |
ggttaactcctttcttgcctcttttggagaaaactgaggcaaagttgtttgaaccatcaacattaatggtgccagagctattgataagggagtgatttct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37241497 |
ggttaactcctttcttgcctcttttggagaaaaccgaggcaaagttgtttgaaccatcaacattaatggtgccagagctattgataagggagtgatttct |
37241398 |
T |
 |
| Q |
119 |
ttttgcttcttttgccaatgcttcagcagcttctctcccactacatttactccttccttttttcattttcaatgactgtgccaatccattgaacatggat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37241397 |
ttttgcttcttttgccaatgcttcagcagcttctctcccactacatttactccttccttttttcattttcaatgactgtgccaatccattgaacatggat |
37241298 |
T |
 |
| Q |
219 |
gaaaaatgacccatcaactctctctgc |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37241297 |
gaaaaatgacccatcaactctctctgc |
37241271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 26 - 156
Target Start/End: Original strand, 46258434 - 46258564
Alignment:
| Q |
26 |
tcctttcttgcctcttttggagaaaactgaggcaaagttgtttgaaccatcaacattaatggtgccagagctattgataagggagtgatttctttttgct |
125 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| | || ||| |||| | || ||| |
|
|
| T |
46258434 |
tcctttctgacctcttttggagaaaattgaggcaaagttgtttgaaccatcaacattaacagtgccagagctacacaaaatcaagtcatttttcttagct |
46258533 |
T |
 |
| Q |
126 |
tcttttgccaatgcttcagcagcttctctcc |
156 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |
|
|
| T |
46258534 |
tcttttgccattgcttcaacagcttctctcc |
46258564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University