View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_high_46 (Length: 250)
Name: NF11901_high_46
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_high_46 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 40415221 - 40414983
Alignment:
| Q |
13 |
gagaaactaaacgaggtctttgtggtaagtctattttcacctttacatatatattaaaatgagtacact----atgaaatttaagaaaaccaactcagat |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40415221 |
gagaaactaaacgaggtctttgcggtaagtctattttcacctttacatatat--taaaatgagtacacttactatgaaatttaagaaaaccaactcagat |
40415124 |
T |
|
| Q |
109 |
cactagcacaactccaatggcacgcgaagtggttgtcgaggtctgcgacatagtaacagagcgcggtgctcgcctagtcggagctggaattgtatcaata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40415123 |
cactagcacaactccaatggcacgcgaagtggttgtcgaggtctgcaacatagtaacagagcgcggtgctcgcctagtcgg-gctggaattgtatcaata |
40415025 |
T |
|
| Q |
209 |
atagaaaaagcgtagttacggttgaaggtggactttatgaac |
250 |
Q |
| |
|
||||||||||| | |||||||||||| || ||||||||||| |
|
|
| T |
40415024 |
atagaaaaagcatggttacggttgaaattgaactttatgaac |
40414983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University