View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_high_47 (Length: 250)
Name: NF11901_high_47
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_high_47 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 24506851 - 24506597
Alignment:
| Q |
12 |
ataggaagatcaaaacaagtatttcgttggggacgaccaagttttagcaatgcagctgtccgaacgaacatctctaccaaaacgaaggaaataatttccc |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24506851 |
atagaaagatcaaaacaagtatttcgttggggacgaccaagttttagcaatgcagctgtccgaacgaacatctctaccaaaacgaaggaagtaatttccc |
24506752 |
T |
 |
| Q |
112 |
tttagacattgatgaatcgaccgaggatgtcgctgatgttctcatttctcaatgtcaaatgtatgaacaagtaggtcttgt----------------atg |
195 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||| |
|
|
| T |
24506751 |
tttagacattgatgaatcgactgaggatgtcgctgatgttctcatttctcaatgtcaaatttatgaacaagtaggtcttttgttgaatgacatgtcgatg |
24506652 |
T |
 |
| Q |
196 |
gactatttgggtttcagggagcagtttcaacatgctttgaataacctttctctct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24506651 |
gactatttgggtttcagggagcagtttcaacatgctttgaataacctttctctct |
24506597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University