View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_high_57 (Length: 234)
Name: NF11901_high_57
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_high_57 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 2 - 234
Target Start/End: Original strand, 11884600 - 11884832
Alignment:
| Q |
2 |
atattccatacctacgaaagaagctttgtgctgtgtttcctctttggcaatatttgcacgactcactattatcccggaaaattcaggcacttctttttca |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11884600 |
atattccatacctacgaaagaagctttgtgctgtgtttcctctttggcaatatttgcacgactcactattatcccggaaaattcacgcacttctttttca |
11884699 |
T |
 |
| Q |
102 |
gggaatctcaaaactaaaagcggaagtagattagtcttggatgcagacagaaagaaaacacttgaatgcaaaattcgagtatttatcttgtttgatgatt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11884700 |
gggaatctcaaaactaaaagcggaagtagattagtcttggatgcagacagaaagaaaacacttgaatgcaaaattcgagtatttatcttgtttgatgatt |
11884799 |
T |
 |
| Q |
202 |
tttattccaatctcattcattatttatttactt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11884800 |
tttattccaatctcattcattatttatttactt |
11884832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University