View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_high_61 (Length: 228)
Name: NF11901_high_61
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_high_61 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 118 - 228
Target Start/End: Complemental strand, 55484862 - 55484752
Alignment:
| Q |
118 |
gaaagtccgaggcgattgtcttggtggccttaccttaccggccatggcatatgcatgatgttcaatatctatattatgacgtaagagcaacatgataatt |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55484862 |
gaaagtctgaggcgattgtcttggtggccttaccttaccgggcatggcatatgcatgatgttcaatatctatattatgacgtaagagcaacatgataatt |
55484763 |
T |
|
| Q |
218 |
tagaataaaaa |
228 |
Q |
| |
|
||||| ||||| |
|
|
| T |
55484762 |
tagaagaaaaa |
55484752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University