View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_low_24 (Length: 398)
Name: NF11901_low_24
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 43307674 - 43307986
Alignment:
| Q |
1 |
gaacccaataataaaatgaatcaactttcaccaattattgctatgatgtgtatttttaaaaaactagcggatctaattggtgtggt-----tgttatatt |
95 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| || |||||| |
|
|
| T |
43307674 |
gaacccaataacaaaattaatcaactttcaccaattattgctatgatgtgtatttttaaaaatctagcggatctaattggtatggtatggttgatatatt |
43307773 |
T |
 |
| Q |
96 |
attgtcttaaattgtaattatcgagtggtgattcaggcagcctacttgctacaatataatagcatttaaggtgtttaactgctcgtaaatcaaatgcttt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43307774 |
attgtcttaaattgtaattatcgagtggtgattcaggcagcctacttgctacaatataatagcatttaaggtgtttaactgctcgtaaatcaaatgcttt |
43307873 |
T |
 |
| Q |
196 |
tgctcttcagacttgctgagatttttctctgaagctggtctagtaagctctagtacatttttattatattg---acttgtatgtatcaaacattaatttg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43307874 |
tgctcttcagacttgctgagatttttctctgaagctggtctagtaagctctagtacatttttattatattgaccacttgtatgtatcaaacattaatttg |
43307973 |
T |
 |
| Q |
293 |
tctctaatcattt |
305 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43307974 |
tctctaatcattt |
43307986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 14 - 95
Target Start/End: Original strand, 33744112 - 33744193
Alignment:
| Q |
14 |
aaatgaatcaactttcaccaattattgctatgatgtgtatttttaaaaaactagcggatctaattggtgtggttgttatatt |
95 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||| |
|
|
| T |
33744112 |
aaattaatcaactttcaccaattattgctatgatgtgtatttttaaaaatctagcggatctaattggtatggttgatatatt |
33744193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University