View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_low_34 (Length: 330)
Name: NF11901_low_34
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 14703689 - 14703501
Alignment:
| Q |
19 |
aaatggtgtcctttccaagatggaatttcttggtacctttcttccacggtatccttgttcttcttcattcacctgaaaagtgatattgatgcagtcatta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14703689 |
aaatggtgtcctttccaagatggaatttcttggtacctttcttccacggaatccttgttcttcttcattcacctgaaaagtgatattgatgcagtcatta |
14703590 |
T |
|
| Q |
119 |
aaattgtcaagtactgctagattacaaaaacaggtagggttttctatggaaattacatgtcatgaaagtgacttgctagacataacaag |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14703589 |
aaattgtcaagtactgctagattacaaaaacaggtagggttttctatggaaattacatgtcatgaaagtgacttgctagacataacaag |
14703501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 276 - 325
Target Start/End: Complemental strand, 14703428 - 14703379
Alignment:
| Q |
276 |
ctactttagcctctcttattcaaatgtactcttgttgactctctgcttct |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14703428 |
ctactttagcctctcttattcaaatgtactcttgttgactcattgcttct |
14703379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University