View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_low_37 (Length: 299)
Name: NF11901_low_37
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 11 - 283
Target Start/End: Original strand, 29789752 - 29790024
Alignment:
| Q |
11 |
catagggtagcctttaatccggggaaataaaaaatattgaatgggtcatgcatcgttttctaatttatgagtgacgtacaagttgcacatgcaattgaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29789752 |
catagggtagcctttaatccggggaaataaaaaatattgaatgggtcatgcatcgttttctaatttatgagtgacgtacaagttgcacatgcaattgaaa |
29789851 |
T |
 |
| Q |
111 |
gtgaccctttaaatagaacataacagcaaatctaaatctcacttatgatgcttggtttgtttaaccattgtaagcaaacaatcatattaatctactttaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29789852 |
gtgaccctttaaatagaacataacagcaaatctaaatctcacttatgatgcttggtttgtttaaccattgtaagcaaacaatcatattaatctactttaa |
29789951 |
T |
 |
| Q |
211 |
ttaattgttcatgtgcaacataccccacgtcgtgcatcttgccttccaacaccaacatagagtagttaagaag |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29789952 |
ttaattgttcatgtgcaacataccccacgtcgtgcatcttgccttccaacaccaacatagagtagttaagaag |
29790024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University