View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_low_38 (Length: 295)
Name: NF11901_low_38
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 159 - 293
Target Start/End: Original strand, 30008753 - 30008889
Alignment:
| Q |
159 |
tgtaaattttatagactcttatatttaatccaaaatttattttctttaacaagtttatttatttgtggcattagttaaataatttttctctcc--gtgtt |
256 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30008753 |
tgtaaattttatagactcctatatttaatccaaaatttattttctttaacaagtttatttatttgtggcattagttaaataatttttctctccctgtgtt |
30008852 |
T |
 |
| Q |
257 |
tgcagccaagatcctaccttgcaaccataatactcca |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30008853 |
tgcagccaagatcctaccttgcaaccataatactcca |
30008889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 11 - 137
Target Start/End: Original strand, 30008583 - 30008709
Alignment:
| Q |
11 |
cattaatatatagattttttacactatgaatcaactataattataatcgtttgatcattaaaaatatttgacttcaatcattatttaaatgttaaataca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30008583 |
cattaatatatagattttttacactatgaatcaactagaattaaaatcgtttgatgattaaaaatatttgacttcaatcattatttaaatgttaaataca |
30008682 |
T |
 |
| Q |
111 |
ttttagtcatacagttttgtaatttgt |
137 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30008683 |
ttttagtcatacagttttgtaatttgt |
30008709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 49 - 81
Target Start/End: Complemental strand, 13343926 - 13343894
Alignment:
| Q |
49 |
aattataatcgtttgatcattaaaaatatttga |
81 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
13343926 |
aattataatcatttgatcattaaaaatatttga |
13343894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University