View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_low_41 (Length: 276)
Name: NF11901_low_41
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 20 - 128
Target Start/End: Complemental strand, 8792992 - 8792884
Alignment:
| Q |
20 |
caaatcaacttccctacatcaaaaggaactaatgcagtcccttgcgattgcaatggcttatgcaacacgattctttgagaaggaatggtgaagcaaaagg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8792992 |
caaatcaacttccctacatcaaaaggaactaatgcagtcccttgcgattgcaatggcttatgcaacacgattctttgagaaggaatggtgaagcaaaagg |
8792893 |
T |
 |
| Q |
120 |
tcttctctg |
128 |
Q |
| |
|
||||||||| |
|
|
| T |
8792892 |
tcttctctg |
8792884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University