View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_low_51 (Length: 249)
Name: NF11901_low_51
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 20522757 - 20522633
Alignment:
| Q |
1 |
gccttataaaacatctatagttatgtacatttatataacatgtagcgatataaatatactatgcttaaagcatgaaacttaagagttaagacatatgtct |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20522757 |
gccttataaaacatctatagttatgtaaatttatataacacgtaacgatata------ctatgcttaaagcatgaaacttaagagttaagacata----- |
20522669 |
T |
 |
| Q |
101 |
tctattcttccatatcattagttcaaaaacataactgg |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20522668 |
--tattcttccatatcattagttcaaaaacataactgg |
20522633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 169 - 245
Target Start/End: Complemental strand, 20522606 - 20522530
Alignment:
| Q |
169 |
aacaaaatgaagttataccatattgttatacaaaatgaagagaaaaataaactgtatcatatggtacctatgcttct |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20522606 |
aacaaaatgaagttataccatattgttatacaaaatgaagagaaaaataaactgtatcatatggtacctctgcttct |
20522530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University