View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11901_low_52 (Length: 249)
Name: NF11901_low_52
Description: NF11901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11901_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 30 - 210
Target Start/End: Original strand, 12342478 - 12342658
Alignment:
| Q |
30 |
tacaaaagataaattcacctctttttcgcttctcaacatttaactcaatatttaatcgagcttgaaggtggtggcctctgccgccatgcatgtaaacaat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| ||||||||||||||| ||||||||| |||||| || |
|
|
| T |
12342478 |
tacaaaagataaattcacctctttttcgcttctcaacatttaactcaatattaaatagagcttaaaggtggtggcctctaccgccatgcctgtaaattat |
12342577 |
T |
|
| Q |
130 |
gatttgccgccatgcctctgccgttatgtgctgagaagatgatgaatgaaaacaaagttgattagaagattttaatttgta |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12342578 |
gatttgccgccatgcctctgccgttatgtgctgagaagatgatgaatgaaaacaaagttgattagaagaatttaatttgta |
12342658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 135
Target Start/End: Original strand, 12348162 - 12348222
Alignment:
| Q |
75 |
caatatttaatcgagcttgaaggtggtggcctctgccgccatgcatgtaaacaatgatttg |
135 |
Q |
| |
|
||||||||| | |||| ||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
12348162 |
caatatttagttgagcatgaaggtggtggcggttgctgccatgcctgtaaacaatgatttg |
12348222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University